€5 off first Book Purchase of €50+ | With Code: CHAPTERSBOOKSTORE
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
- Publisher Name:Penguin Books Ltd
- Product Format:Paperback
- ISBN: 9780241954690
- Author:Rutherford, Adam
- Publication Date:2014-02-06
Refund Policy
If you are not satisfied with your order in any way, get in touch. We have an excellent customer service record and we will do our best to ensure you are pleased with your purchase.
📄 Exercise Your Right of Withdrawal
Under EU consumer law, you have the right to withdraw from your purchase within 14 days of receiving your order, without giving a reason. To formally exercise this right, use the button below. This is a distinct function separate from our general returns process.
Your right to cancel
If you order online, you have the right to cancel your order within 14 days of receiving your goods, without giving a reason. This cooling-off period runs from the day you (or someone you nominate) receives the last item in your order. To cancel, contact us at shop@chaptersbookstore.com stating your order number and your wish to withdraw from the purchase. Once we've confirmed your cancellation, you have 14 days to send the goods back to us.
Condition of returned items
To be eligible for a refund, your item must be returned unworn, unused and unread, in its original packaging, and in the same condition you received it. You'll also need your receipt or proof of purchase. If your return is based on the item's condition on arrival, please include a photo so we can advise the best resolution.
Faulty or damaged items
Please inspect your order on arrival and contact us immediately if an item is defective, damaged, or not what you ordered. Separately from the 14-day cancellation right above, you're entitled to a repair, replacement or refund on faulty goods for up to two years from purchase, under standard consumer guarantee rights.
This guarantee covers manufacturing faults only, such as printing errors, missing pages, or binding defects present at the time of purchase. It does not cover damage arising from normal use or wear, including creased spines, worn covers, marked pages or general signs of reading. If you're unsure whether an issue qualifies, send us a photo and we'll be happy to advise.
How to return
To start a return, contact us at shop@chaptersbookstore.com. If your return is accepted, we'll send you a return shipping label and instructions on how and where to send your package. Items sent back to us without first requesting a return will not be accepted. If a return is due to an error on our part, we'll cover the postage cost.
Exceptions and non-returnable items
Certain items cannot be returned, including custom products, special orders, sale items and gift cards.
Trade-In Programme
If you're trading in previously owned books rather than returning a purchase, please see our separate Trade-In Programme terms, which operate independently of this policy.
Refunds
Once we've received and inspected your return, we'll let you know if the refund has been approved. If approved, you'll be refunded automatically to your original payment method. Please allow some time for your bank or card provider to process and post the refund.
Free Delivery in the Republic Of Ireland on all orders over €30. Standard Delivery Charge in Republic of Ireland of €5 for all orders below €30.
Delivery is subject to warehouse availability. Out-of-stock items will be shipped as soon as possible, upon arrival from the manufacturer/publisher. Please take shipping time into consideration.
